Bio::Tools::CodonTable: handle negative table ids as invalid (#386)
[bioperl-live.git] / t / data / tandem_repeats_finder_no_desc.dat
blobc4a8cbcea65c9d665a86e0ae09bebe2f5457941d
1 Tandem Repeats Finder Program writen by:
5 Gary Benson
7 Department of Biomathematical Sciences
9 Mount Sinai School of Medicine
11 Version 4.00
17 Sequence: DDB0169550
25 Parameters: 2 7 7 80 10 50 12
31 13936 13960 12 2.1 12 100 0 50 16 8 52 24 1.70 GGCGTAATGGGT GGCGTAATGGGTGGCGTAATGGGTG
33 16937 16965 9 3.2 9 100 0 58 44 0 10 44 1.38 TATATAGTA TATATAGTATATATAGTATATATAGTATA
41 Sequence: DDB0215018 |Masked Chromosomal Sequence| on chromosome: 2F
49 Parameters: 2 7 7 80 10 50 12
55 1649 1679 1 31.0 1 100 0 62 0 0 0 100 0.00 T TTTTTTTTTTTTTTTTTTTTTTTTTTTTTTT