t/data/roa1.gbxml

   1 <?xml version="1.0"?>
   2 <!DOCTYPE Bioseq-set PUBLIC "-//NCBI//NCBI Seqset/EN" "http://www.ncbi.nlm.nih.gov/dtd/NCBI_Seqset.dtd">
   3 <Bioseq-set>
   4 <Bioseq-set_seq-set>
   5 <Seq-entry>
   6   <Seq-entry_seq>
   7     <Bioseq>
   8       <Bioseq_id>
   9         <Seq-id>
  10           <Seq-id_general>
  11             <Dbtag>
  12               <Dbtag_db>dbEST</Dbtag_db>
  13               <Dbtag_tag>
  14                 <Object-id>
  15                   <Object-id_id>1888424</Object-id_id>
  16                 </Object-id>
  17               </Dbtag_tag>
  18             </Dbtag>
  19           </Seq-id_general>
  20         </Seq-id>
  21         <Seq-id>
  22           <Seq-id_genbank>
  23             <Textseq-id>
  24               <Textseq-id_accession>AI129902</Textseq-id_accession>
  25               <Textseq-id_version>1</Textseq-id_version>
  26             </Textseq-id>
  27           </Seq-id_genbank>
  28         </Seq-id>
  29         <Seq-id>
  30           <Seq-id_gi>3598416</Seq-id_gi>
  31         </Seq-id>
  32       </Bioseq_id>
  33       <Bioseq_descr>
  34         <Seq-descr>
  35           <Seqdesc>
  36             <Seqdesc_molinfo>
  37               <MolInfo>
  38                 <MolInfo_biomol value="mRNA">3</MolInfo_biomol>
  39                 <MolInfo_tech value="est">2</MolInfo_tech>
  40               </MolInfo>
  41             </Seqdesc_molinfo>
  42           </Seqdesc>
  43           <Seqdesc>
  44             <Seqdesc_title>qc41b07.x1 Soares_pregnant_uterus_NbHPU Homo sapiens cDNA clone IMAGE:1712149 3&apos; similar to SW:ROA1_SCHAM P21522 HETEROGENEOUS NUCLEAR RIBONUCLEOPROTEIN A1, A2/B1 HOMOLOG. ;contains MSR1.b2 MSR1 repetitive element ;.</Seqdesc_title>
  45           </Seqdesc>
  46           <Seqdesc>
  47             <Seqdesc_create-date>
  48               <Date>
  49                 <Date_std>
  50                   <Date-std>
  51                     <Date-std_year>1998</Date-std_year>
  52                     <Date-std_month>9</Date-std_month>
  53                     <Date-std_day>10</Date-std_day>
  54                   </Date-std>
  55                 </Date_std>
  56               </Date>
  57             </Seqdesc_create-date>
  58           </Seqdesc>
  59           <Seqdesc>
  60             <Seqdesc_update-date>
  61               <Date>
  62                 <Date_std>
  63                   <Date-std>
  64                     <Date-std_year>1998</Date-std_year>
  65                     <Date-std_month>10</Date-std_month>
  66                     <Date-std_day>27</Date-std_day>
  67                   </Date-std>
  68                 </Date_std>
  69               </Date>
  70             </Seqdesc_update-date>
  71           </Seqdesc>
  72           <Seqdesc>
  73             <Seqdesc_comment>Contact: Robert Strausberg, Ph.D.~Email: cgapbs-r@mail.nih.gov~This clone is available royalty-free through LLNL ; contact the IMAGE Consortium (info@image.llnl.gov) for further information. ~Trace considered overall poor quality~Insert Length: 525   Std Error: 0.00~Seq primer: -40m13 fwd. ET from Amersham~High quality sequence stop: 1</Seqdesc_comment>
  74           </Seqdesc>
  75           <Seqdesc>
  76             <Seqdesc_source>
  77               <BioSource>
  78                 <BioSource_org>
  79                   <Org-ref>
  80                     <Org-ref_taxname>Homo sapiens</Org-ref_taxname>
  81                     <Org-ref_common>human</Org-ref_common>
  82                     <Org-ref_db>
  83                       <Dbtag>
  84                         <Dbtag_db>taxon</Dbtag_db>
  85                         <Dbtag_tag>
  86                           <Object-id>
  87                             <Object-id_id>9606</Object-id_id>
  88                           </Object-id>
  89                         </Dbtag_tag>
  90                       </Dbtag>
  91                     </Org-ref_db>
  92                     <Org-ref_orgname>
  93                       <OrgName>
  94                         <OrgName_name>
  95                           <OrgName_name_binomial>
  96                             <BinomialOrgName>
  97                               <BinomialOrgName_genus>Homo</BinomialOrgName_genus>
  98                               <BinomialOrgName_species>sapiens</BinomialOrgName_species>
  99                             </BinomialOrgName>
 100                           </OrgName_name_binomial>
 101                         </OrgName_name>
 102                         <OrgName_mod>
 103                           <OrgMod>
 104                             <OrgMod_subtype value="other">255</OrgMod_subtype>
 105                             <OrgMod_subname>Organ: uterus; Vector: pT7T3D-PacI; Site_1: Not I; Site_2: Eco RI; 1st strand cDNA was primed with a Not I - oligo(dT) primer [5&apos; AACTGGAAGAATTCGCGGCCGCCTTTTTTTTTTTTTTTTTT 3&apos;], double-stranded cDNA was ligated to Eco RI adaptors (Pharmacia), digested with Not I and cloned into the Not I and Eco RI sites of the modified pT7T3 vector. Library went through one round of normalization.  Library constructed by M. Fatima Bonaldo.</OrgMod_subname>
 106                           </OrgMod>
 107                         </OrgName_mod>
 108                         <OrgName_lineage>Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Mammalia; Eutheria; Euarchontoglires; Primates; Haplorrhini; Catarrhini; Hominidae; Homo</OrgName_lineage>
 109                         <OrgName_gcode>1</OrgName_gcode>
 110                         <OrgName_mgcode>2</OrgName_mgcode>
 111                         <OrgName_div>PRI</OrgName_div>
 112                       </OrgName>
 113                     </Org-ref_orgname>
 114                   </Org-ref>
 115                 </BioSource_org>
 116                 <BioSource_subtype>
 117                   <SubSource>
 118                     <SubSource_subtype value="clone">3</SubSource_subtype>
 119                     <SubSource_name>IMAGE:1712149</SubSource_name>
 120                   </SubSource>
 121                   <SubSource>
 122                     <SubSource_subtype value="clone-lib">11</SubSource_subtype>
 123                     <SubSource_name>Soares_pregnant_uterus_NbHPU</SubSource_name>
 124                   </SubSource>
 125                   <SubSource>
 126                     <SubSource_subtype value="sex">7</SubSource_subtype>
 127                     <SubSource_name>female</SubSource_name>
 128                   </SubSource>
 129                   <SubSource>
 130                     <SubSource_subtype value="dev-stage">12</SubSource_subtype>
 131                     <SubSource_name>adult</SubSource_name>
 132                   </SubSource>
 133                   <SubSource>
 134                     <SubSource_subtype value="lab-host">16</SubSource_subtype>
 135                     <SubSource_name>DH10B</SubSource_name>
 136                   </SubSource>
 137                 </BioSource_subtype>
 138               </BioSource>
 139             </Seqdesc_source>
 140           </Seqdesc>
 141           <Seqdesc>
 142             <Seqdesc_pub>
 143               <Pubdesc>
 144                 <Pubdesc_pub>
 145                   <Pub-equiv>
 146                     <Pub>
 147                       <Pub_gen>
 148                         <Cit-gen>
 149                           <Cit-gen_cit>Unpublished</Cit-gen_cit>
 150                           <Cit-gen_authors>
 151                             <Auth-list>
 152                               <Auth-list_names>
 153                                 <Auth-list_names_std>
 154                                   <Author>
 155                                     <Author_name>
 156                                       <Person-id>
 157                                         <Person-id_name>
 158                                           <Name-std>
 159                                             <Name-std_last>NCI-CGAP http://www.ncbi.nlm.nih.gov/ncicgap</Name-std_last>
 160                                           </Name-std>
 161                                         </Person-id_name>
 162                                       </Person-id>
 163                                     </Author_name>
 164                                   </Author>
 165                                 </Auth-list_names_std>
 166                               </Auth-list_names>
 167                             </Auth-list>
 168                           </Cit-gen_authors>
 169                           <Cit-gen_date>
 170                             <Date>
 171                               <Date_std>
 172                                 <Date-std>
 173                                   <Date-std_year>1997</Date-std_year>
 174                                 </Date-std>
 175                               </Date_std>
 176                             </Date>
 177                           </Cit-gen_date>
 178                           <Cit-gen_title>National Cancer Institute, Cancer Genome Anatomy Project (CGAP), Tumor Gene Index</Cit-gen_title>
 179                         </Cit-gen>
 180                       </Pub_gen>
 181                     </Pub>
 182                   </Pub-equiv>
 183                 </Pubdesc_pub>
 184               </Pubdesc>
 185             </Seqdesc_pub>
 186           </Seqdesc>
 187         </Seq-descr>
 188       </Bioseq_descr>
 189       <Bioseq_inst>
 190         <Seq-inst>
 191           <Seq-inst_repr value="raw"/>
 192           <Seq-inst_mol value="rna"/>
 193           <Seq-inst_length>37</Seq-inst_length>
 194           <Seq-inst_strand value="ss"/>
 195           <Seq-inst_seq-data>
 196             <Seq-data>
 197               <Seq-data_iupacna>
 198                 <IUPACna>CTCCGCGCCAACTCCCCCCACCCCCCCCCCACACCCC</IUPACna>
 199               </Seq-data_iupacna>
 200             </Seq-data>
 201           </Seq-inst_seq-data>
 202         </Seq-inst>
 203       </Bioseq_inst>
 204     </Bioseq>
 205   </Seq-entry_seq>
 206 </Seq-entry>
 207 </Bioseq-set_seq-set>
 208 </Bioseq-set>