1 BLASTN 2.1.2 [Oct-19-2000]
4 Reference: Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer,
5 Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997),
6 "Gapped BLAST and PSI-BLAST: a new generation of protein database search
7 programs", Nucleic Acids Res. 25:3389-3402.
9 Query= AE003528 Drosophila melanogaster genomic scaffold
10 142000013386050 section 40 of 54, complete sequence.
14 400 sequences; 4,662,239 total letters
16 Searching.................................................done
19 Sequences producing significant alignments: (bits) Value
21 gb|AE000450.1|AE000450 Escherichia coli K-12 MG1655 section 340 ... 60 1e-06
22 gb|AE000359.1|AE000359 Escherichia coli K-12 MG1655 section 249 ... 48 0.004
23 gb|AE000281.1|AE000281 Escherichia coli K-12 MG1655 section 171 ... 40 1.1
24 gb|AE000274.1|AE000274 Escherichia coli K-12 MG1655 section 164 ... 40 1.1
25 gb|AE000117.1|AE000117 Escherichia coli K-12 MG1655 section 7 of... 40 1.1
26 gb|AE000502.1|AE000502 Escherichia coli K-12 MG1655 section 392 ... 38 4.3
27 gb|AE000454.1|AE000454 Escherichia coli K-12 MG1655 section 344 ... 38 4.3
28 gb|AE000443.1|AE000443 Escherichia coli K-12 MG1655 section 333 ... 38 4.3
29 gb|AE000404.1|AE000404 Escherichia coli K-12 MG1655 section 294 ... 38 4.3
30 gb|AE000369.1|AE000369 Escherichia coli K-12 MG1655 section 259 ... 38 4.3
31 gb|AE000287.1|AE000287 Escherichia coli K-12 MG1655 section 177 ... 38 4.3
32 gb|AE000283.1|AE000283 Escherichia coli K-12 MG1655 section 173 ... 38 4.3
33 gb|AE000253.1|AE000253 Escherichia coli K-12 MG1655 section 143 ... 38 4.3
34 gb|AE000201.1|AE000201 Escherichia coli K-12 MG1655 section 91 o... 38 4.3
36 >gb|AE000450.1|AE000450 Escherichia coli K-12 MG1655 section 340 of 400 of the complete genome
39 Score = 60.0 bits (30), Expect = 1e-06
40 Identities = 36/38 (94%)
44 Query: 79116 gacatcatcgccattctgggaatggatgaactgtctga 79153
45 |||||||||||||| ||||| |||||||||||||||||
46 Sbjct: 4712 gacatcatcgccatcctgggtatggatgaactgtctga 4675
49 Score = 40.1 bits (20), Expect = 1.1
50 Identities = 23/24 (95%)
54 Query: 78617 tggccagatgaacgagcccccggg 78640
55 |||||||||||||||||| |||||
56 Sbjct: 5208 tggccagatgaacgagccgccggg 5185
59 >gb|AE000359.1|AE000359 Escherichia coli K-12 MG1655 section 249 of 400 of the complete genome
62 Score = 48.1 bits (24), Expect = 0.004
63 Identities = 24/24 (100%)
67 Query: 193000 tgttgctgctgttgcagattgctg 193023
68 ||||||||||||||||||||||||
69 Sbjct: 10696 tgttgctgctgttgcagattgctg 10673
72 >gb|AE000281.1|AE000281 Escherichia coli K-12 MG1655 section 171 of 400 of the complete genome
75 Score = 40.1 bits (20), Expect = 1.1
76 Identities = 23/24 (95%)
80 Query: 211974 ataaatatgtgcaccattagtaac 211997
81 |||||||||||| |||||||||||
82 Sbjct: 3068 ataaatatgtgcgccattagtaac 3091
85 >gb|AE000274.1|AE000274 Escherichia coli K-12 MG1655 section 164 of 400 of the complete genome
88 Score = 40.1 bits (20), Expect = 1.1
89 Identities = 23/24 (95%)
93 Query: 227803 ctggagatgctggaaatgctcact 227826
94 |||||||||||||||||| |||||
95 Sbjct: 3532 ctggagatgctggaaatggtcact 3555
98 >gb|AE000117.1|AE000117 Escherichia coli K-12 MG1655 section 7 of 400 of the complete genome
101 Score = 40.1 bits (20), Expect = 1.1
102 Identities = 20/20 (100%)
103 Strand = Plus / Minus
106 Query: 2754 gctgctgctgttgctgccac 2773
108 Sbjct: 3441 gctgctgctgttgctgccac 3422
111 >gb|AE000502.1|AE000502 Escherichia coli K-12 MG1655 section 392 of 400 of the complete genome
114 Score = 38.2 bits (19), Expect = 4.3
115 Identities = 22/23 (95%)
119 Query: 171913 ttttatgtagattttacttgtta 171935
120 |||||||| ||||||||||||||
121 Sbjct: 428 ttttatgttgattttacttgtta 450
124 >gb|AE000454.1|AE000454 Escherichia coli K-12 MG1655 section 344 of 400 of the complete genome
127 Score = 38.2 bits (19), Expect = 4.3
128 Identities = 19/19 (100%)
129 Strand = Plus / Minus
132 Query: 176663 agacaaatttatgagcgtt 176681
134 Sbjct: 9769 agacaaatttatgagcgtt 9751
137 >gb|AE000443.1|AE000443 Escherichia coli K-12 MG1655 section 333 of 400 of the complete genome
140 Score = 38.2 bits (19), Expect = 4.3
141 Identities = 19/19 (100%)
145 Query: 160348 gcatttgttgtttgcggac 160366
147 Sbjct: 8826 gcatttgttgtttgcggac 8844
150 >gb|AE000404.1|AE000404 Escherichia coli K-12 MG1655 section 294 of 400 of the complete genome
153 Score = 38.2 bits (19), Expect = 4.3
154 Identities = 19/19 (100%)
155 Strand = Plus / Minus
158 Query: 193629 ttagcgaccaccacgtcgg 193647
160 Sbjct: 13496 ttagcgaccaccacgtcgg 13478
163 >gb|AE000369.1|AE000369 Escherichia coli K-12 MG1655 section 259 of 400 of the complete genome
166 Score = 38.2 bits (19), Expect = 4.3
167 Identities = 22/23 (95%)
168 Strand = Plus / Minus
171 Query: 50797 catcaatattattgaatatttca 50819
172 ||||| |||||||||||||||||
173 Sbjct: 869 catcactattattgaatatttca 847
176 >gb|AE000287.1|AE000287 Escherichia coli K-12 MG1655 section 177 of 400 of the complete genome
179 Score = 38.2 bits (19), Expect = 4.3
180 Identities = 19/19 (100%)
184 Query: 94068 tcaccagccagccgctgcc 94086
186 Sbjct: 443 tcaccagccagccgctgcc 461
189 >gb|AE000283.1|AE000283 Escherichia coli K-12 MG1655 section 173 of 400 of the complete genome
192 Score = 38.2 bits (19), Expect = 4.3
193 Identities = 19/19 (100%)
194 Strand = Plus / Minus
197 Query: 104663 acgttagcggcactgactc 104681
199 Sbjct: 893 acgttagcggcactgactc 875
202 >gb|AE000253.1|AE000253 Escherichia coli K-12 MG1655 section 143 of 400 of the complete genome
205 Score = 38.2 bits (19), Expect = 4.3
206 Identities = 19/19 (100%)
207 Strand = Plus / Minus
210 Query: 191578 cgttgaaaatggaaatctt 191596
212 Sbjct: 2595 cgttgaaaatggaaatctt 2577
215 >gb|AE000201.1|AE000201 Escherichia coli K-12 MG1655 section 91 of 400 of the complete genome
218 Score = 38.2 bits (19), Expect = 4.3
219 Identities = 19/19 (100%)
223 Query: 249230 tggctgctgctccagttgt 249248
225 Sbjct: 2297 tggctgctgctccagttgt 2315
229 Posted date: Jun 14, 2001 3:27 PM
230 Number of letters in database: 4,662,239
231 Number of sequences in database: 400
241 Matrix: blastn matrix:1 -3
242 Gap Penalties: Existence: 5, Extension: 2
243 Number of Hits to DB: 592338
244 Number of Sequences: 400
245 Number of extensions: 592338
246 Number of successful extensions: 42599
247 Number of sequences better than 10.0: 14
248 length of query: 283821
249 length of database: 4,662,239
250 effective HSP length: 20
251 effective length of query: 283801
252 effective length of database: 4,654,239
253 effective search space: 1320877682439
254 effective search space used: 1320877682439