t/*: remove "use lib '.'" and t/lib/Error.pm
[bioperl-live.git] / t / LocalDB / Index / Index.t
blob07be79f6bbe646459433333f04b5e6954bbc8397
1 # -*-Perl-*- Test Harness script for Bioperl
2 # $Id$
4 use strict;
6 BEGIN {
7    use Bio::Root::Test;
8    
9    test_begin(-tests => 65,
10               -requires_modules => [qw(DB_File
11                                        Storable
12                                        Fcntl)]);
13    
14    use_ok('Bio::Index::Fasta');
15    use_ok('Bio::Index::Qual');
16    use_ok('Bio::Index::SwissPfam');
17    use_ok('Bio::Index::EMBL');
18    use_ok('Bio::Index::GenBank');
19    use_ok('Bio::Index::Swissprot');
20    use_ok('Bio::DB::InMemoryCache');
21    use_ok('Bio::DB::InMemoryCache');
24 my $ind = Bio::Index::Fasta->new(-filename => 'Wibbl',
25                                  -write_flag => 1,
26                                  -verbose => 0);
27 $ind->make_index(test_input_file('multifa.seq'));
28 $ind->make_index(test_input_file('seqs.fas'));
30 ok ( -e "Wibbl" || -e "Wibbl.pag" );
31 my $seq = $ind->fetch('HSEARLOBE');
32 is($seq->length,321);
33 is($seq->primary_id(),'HSEARLOBE');
34 $seq = $ind->fetch('HSMETOO');
35 is($seq->length,134);
36 is($seq->primary_id(),'HSMETOO');
37 $seq = $ind->fetch('MMWHISK');
38 is($seq->length,62);
39 is($seq->primary_id(),'MMWHISK');
40 $seq = $ind->fetch('gi|238775|bbs|65126');
41 is($seq->length,70);
43 my $stream = $ind->get_PrimarySeq_stream();
44 $seq = $stream->next_seq;
45 isa_ok $seq, 'Bio::PrimarySeqI';
47 $ind = Bio::Index::Fasta->new(-filename => 'multifa_index',
48                               -write_flag => 1,
49                               -verbose => 0);
50 $ind->make_index(test_input_file('multifa.seq.qual'));
52 ok ( -e "multifa_index" );
54 $ind = Bio::Index::Qual->new(-filename => 'multifa_qual_index',
55                              -write_flag => 1,
56                              -verbose => 0);
57 $ind->make_index(test_input_file('multifa.seq.qual'));
59 ok ( -e "multifa_qual_index" );
61 ok ( defined($seq) );
62 isa_ok $seq, 'Bio::SeqI';
63 $seq = $ind->fetch('HSEARLOBE');
64 is($seq->length,321);
65 is($seq->primary_id(),'HSEARLOBE');
66 $seq = $ind->fetch('HSMETOO');
67 is($seq->length,134);
68 is($seq->primary_id(),'HSMETOO');
69 $seq = $ind->fetch('MMWHISK');
70 is($seq->length,62);
71 is($seq->primary_id(),'MMWHISK');
72 $seq = $ind->fetch('NONEXISTENT_SEQ');
73 ok(! defined $seq);
75 $ind = Bio::Index::SwissPfam->new(-filename => 'Wibbl2',
76                                   -write_flag =>1);
77 $ind->make_index(test_input_file('swisspfam.data'));
79 ok ( -e "Wibbl2" || -e "Wibbl2.pag" );
81 $ind = Bio::Index::EMBL->new(-filename   => 'Wibbl3',
82                              -write_flag =>1);
83 $ind->make_index(test_input_file('test.embl'));
84 ok ( -e "Wibbl3" || -e "Wibbl3.pag" );
85 is ($ind->fetch('AL031232')->length, 4870);
87 SKIP: {
88     test_skip(-tests => 5, -requires_module => 'Data::Stag');
89     $ind = Bio::Index::Swissprot->new(-filename   => 'Wibbl4',
90                                       -write_flag => 1);
91     $ind->make_index(test_input_file('roa1.swiss'));
92     ok ( -e "Wibbl4" || -e "Wibbl4.pag" );
93     $seq = $ind->fetch('ROA1_HUMAN');
94     is ($seq->display_id(), 'ROA1_HUMAN');
95     $seq = $ind->fetch('P09651');
96     is ($seq->display_id(), 'ROA1_HUMAN');
98     # test id_parser
99     $ind = Bio::Index::Swissprot->new(-filename   => 'Wibbl4',
100                                       -write_flag => 1);
101     $ind->id_parser(\&get_id);
102     $ind->make_index(test_input_file('roa1.swiss'));
103     ok ( -e "Wibbl4" || -e "Wibbl4.pag" );
104     $seq = $ind->fetch('X12671');
105     is ($seq->length,371);
109 my $gb_ind = Bio::Index::GenBank->new(-filename => 'Wibbl5',
110                                       -write_flag =>1,
111                                       -verbose    => 0);
112 $gb_ind->make_index(test_input_file('roa1.genbank'));
113 ok ( -e "Wibbl5" || -e "Wibbl5.pag" );
114 $seq = $gb_ind->fetch('AI129902');
115 is ($seq->length, 37);
116 is ($seq->species->binomial, 'Homo sapiens');
117 $seq = $gb_ind->fetch(3598416);
118 is ($seq->seq,"CTCCGCGCCAACTCCCCCCACCCCCCCCCCACACCCC");
120 my $cache = Bio::DB::InMemoryCache->new( -seqdb => $gb_ind );
122 ok ( $cache->get_Seq_by_id('AI129902') );
124 SKIP: {
125    test_skip(-tests => 22, -requires_module => 'Bio::DB::FileCache');
127    $cache = Bio::DB::FileCache->new(-seqdb => $gb_ind,
128                                     -keep  => 1,
129                                     -file  => 'filecache.idx');
130    # problem:
131    my $seq = $cache->get_Seq_by_id('AI129902');
132    ok ( $seq);
133    is ( $seq->length, 37);
134    is ( lc($seq->seq()), 'ctccgcgccaactccccccaccccccccccacacccc');
136    my ( $f1 ) = $seq->get_SeqFeatures();
137    is ( ($f1->get_tag_values('sex'))[0], 'female');
138    is ( ($f1->get_tag_values('lab_host'))[0], 'DH10B');
139    my $species = $seq->species;
140    ok( $species );
141    is( $species->binomial, 'Homo sapiens');
142    is( $species->species(), 'sapiens');
143    is( $species->genus(), 'Homo');
144    # changes in GenBank file SOURCE line
145    # this is now the abbreviated name
146    ok defined($species->name('abbreviated'));
147    is ($species->name('abbreviated')->[0], 'human');
149    $cache = undef;
150    $cache = Bio::DB::FileCache->new(-seqdb => $gb_ind,
151                                     -keep  => 0,
152                                     -file  => 'filecache.idx');
153    $seq = $cache->get_Seq_by_id('AI129902');
154    ok ( $seq);
155    is ( $seq->length, 37);
156    is ( lc($seq->seq()), 'ctccgcgccaactccccccaccccccccccacacccc');
158    ( $f1 ) = $seq->get_SeqFeatures();
159    is ( ($f1->get_tag_values('sex'))[0], 'female');
160    is ( ($f1->get_tag_values('lab_host'))[0], 'DH10B');
161    $species = $seq->species;
162    ok( $species );
163    is( $species->binomial, 'Homo sapiens');
164    is( $species->species(), 'sapiens');
165    is( $species->genus(), 'Homo');
166    # changes in GenBank file SOURCE line
167    # this is now the abbreviated name
168    ok defined($species->name('abbreviated'));
169    is ($species->name('abbreviated')->[0], 'human');
172 # test id_parser
173 $gb_ind = Bio::Index::GenBank->new(-filename => 'Wibbl5',
174                                    -write_flag =>1,
175                                    -verbose    => 0);
176 $gb_ind->id_parser(\&get_id);
177 $gb_ind->make_index(test_input_file('roa1.genbank'));
178 ok ( -e "Wibbl5" || -e "Wibbl5.pag" );
179 $seq = $gb_ind->fetch('alpha D-globin');
180 is ($seq->length,141);
182 sub get_id {
183    my $line = shift;
184    return $1 if ($line =~ /product="([^"]+)"/);
185    return $1 if ($line =~ /^DR\s+EMBL;\s+([^;]+)/);
188 END {
189    cleanup();
192 sub cleanup {
193    for my $root ( qw( Wibbl Wibbl2 Wibbl3 Wibbl4 Wibbl5
194                       multifa_index multifa_qual_index ) ) {
195       unlink $root if( -e $root );
196       unlink "$root.pag" if( -e "$root.pag");
197       unlink "$root.dir" if( -e "$root.dir");
198    }